seq = "CCGGAAGAGCTTACTTAG"īasecomplement = Īnd you can then use this to convert any sequence of bases, amino_acids for a in zip(*(*3))īy way of explanation, zip(*(*3)) groups the characters three at a time. I have tried the next code to get my results, but so i get just a complementair seq. The one with +3 is the amino acid sequence corresponding to my complementary sequence beginning with the third base.The one with +2 is the amino acid sequence corresponding to my complementary sequence starting at the second base.The one with +1 is the amino acid sequence corresponding to my complementary sequence.The second one is the complementary sequence,.The fist sequence is the normal sequence,. +3 TyrIleTyrIleTrpValMetLeuArgLysGlyValProThrLeuValMetLeuValLeuLys +2 IleTyrIleTyrMetGlyHisAlaThrOc*GlyGlySerHisPheGlyHisAlaSerIleglu +1 TyrIleTyrIleTyrGlySerCysTyrValArgGlyPheProLeuTrpSerCysStpTyrStp TATATATATATATATGGGTCATGCTACGTAAGGGGGTTCCCACTTTGGTCATGCTAGTATTGAAA Translation: The process where RNA is used to create a new polypeptide chain (protein).I have to translate the complement of a DNA sequence into amino acids TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA Ribosome: A macromolecule composed of RNA and proteins, located in the cytoplasm or on the rough endoplasmic reticulum, that uses an mRNA sequence to produce a polypeptide chain during translation. Transcript: A RNA molecule that is copied from a DNA sequence during transcription. Uracil (U): A nucleotide specifically found in RNA that replaces the thymine found in DNA. Transcription: The process of converting a specific sequence of DNA into a new RNA molecule.Ĭomplementary: Describes the pairing between specific nucleotides in DNA and RNA. Messenger RNA (mRNA): An RNA molecule that is copied from a DNA sequence during transcription and is used to create a protein during translation. mRNA is used by ribosomes in the cytoplasm to synthesize a polypeptide chain (protein).The mRNA sequence is exactly the same as the non-template strand of DNA mRNA is complementary to the template strand of DNA it is copied from, except the RNA-specific nucleotide uracil replaces thymine.Messenger RNA or mRNA is formed from a DNA sequence in a process known as transcription.Molecular genetics and microbiology of Zaire Ebolavirus If the transcribed gene encodes a protein, the result of transcription is messenger RNA (mRNA), which will then move to ribosomes in the cytoplasm and be used to create a protein in the process of translation. Some transcripts are used as structural or regulatory RNAs, and others encode one or more proteins. The RNA molecule that is copied from a DNA sequence is called a transcript. You can see this represented in the figure below: Unlike DNA replication, transcription results in a RNA complement that substitutes the RNA uracil (U) in all instances where the DNA thymine (T) would have occurred. Both RNA and DNA are nucleic acids, which use base pairs of nucleotides as a complementary language that enzymes can convert back and forth from DNA to RNA. In eukaryotes, this occurs in the nucleus. Messenger RNA or mRNA is a type of RNA that is formed by transcription of DNA and encodes a protein.ĭuring transcription, a DNA sequence is copied into a complementary RNA molecule.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |